![]() | |
| << Sorry ... | Stalkeyed >> | |
|
Prodigal Son
It took Michelangelo eleven months to cover the ceiling of the Sistine Chapel with a series of dizzyingly elaborate patters and illustrations, and he required a team of five painters to do it. The Squirrelly must be some kind of prodigy, because he managed to do essentially the same thing to the hard wood floor in our kitchen in about three minutes, and we only needed a single purloined ball-point pen. I guess we should be mad, but we prefer to focus on the positive. Like, how much money this genius kid is going to rake in for us. The Queen and I agree that a career in bio-engineering would be best suited for the kid, as it's the most likely to result in him having copious amounts of cash to lavish upon us. So, to steer him in that direction, we have decided to only teach him the letters A, C, G, and T. ![]() Awwww, isn't that adorable?! He's making a chinchilla! Or perhaps he could go into IT, as he seems to have an intuitive grasp of how wireless networks work. He often likes to play Elmo's Keyboard-A-Rama on the laptop out in the (newly redecorated) kitchen. When he wants to play he doesn't go to the computer, though: he sort of wanders around the house, staring at a point about three feet above his head and saying "want play Elmo?" as if he can sense the pixilated muppet being sent over the wireless link. Or maybe he thinks that, when Elmo isn't on the screen jovially screeching about the letter "J," he is trapped in some nether dimension between the router in the back of the house to the laptop in the front. You know, like those guys in Superman II: President: [on T.V] This is your President. On behalf of my country and in the name of the other leaders of the world with whom I have today consulted, I hereby abdicate all authority and control over this planet to Elmo. Only by following all his directives will the lives of millions be spared -- Mr. Hooper! Can you hear me? Mr. Hooper! Where are you?!Posted on August 07, 2006 to The Squirrelly Comments
I think Squirrelly must be some kind of genius. Not only does he know his letters already (astoundingly impressive at his age) but he has cracked the genome (terrifying in its implications). I was already impressed he can do Elmo's Keyboard-A-Rama. Those child prodigies! Always showing my kid up! Posted by: ozma on August 8, 2006 9:34 AMIf he starts cloning Elmo, that's when you know you have a problem. Posted by: Fred on August 8, 2006 9:38 AMGrover rules! Elmo drools! Any muppet who refers to himself in the 3rd person and has not been crowned the head of state in some European country or principality should be attached to a mophead and used to clean public toilets! Posted by: groversnumber1fan on August 8, 2006 10:15 AMComing to theatres this fall, GATTACA 2: Squirelly's Revenge Posted by: Sharif on August 8, 2006 10:21 AMWow that is impressive! My boss once asked, "Do you have high standards for you child?" I said yeah. She said, "Well lower them, my son just told me he wants to be a bus driver." I'm still not going to lower them though. ;) Posted by: Wickwire on August 8, 2006 11:05 AMPerhaps you should teach him 'U' as well. Uracil is nearly as important in things genetic. Posted by: Jason F on August 8, 2006 11:53 AMWelcome Back! I never put the whole AGTC - GATTICA thing together before I read these comments. Posted by: Rob Cockerham on August 8, 2006 12:07 PMThe Squirrelly even got an 'F' in there too! So, in summary, if we ever need anyone to spell FAG CAT, like, he's so in! He's a keeper for sure, Matt. Don't throw that one back. Posted by: Kelly on August 8, 2006 1:42 PMha! I love it! kinda reminds me of an xfiles episode where a kid is getting top secret codes through the television static though... Wow, quite the genious indeed... but I don't think I'd steer him toward BIOengineering. Life should be obsolete in a few years. Maybe a rocket scientist? Just make sure the difference between metric and standard/imperical is clear ;) Posted by: Ian Clifton on August 8, 2006 7:34 PMgood god - isn't your son like 3 yrs old? He's got better writing than i do. Posted by: Anonymous on August 9, 2006 6:51 AMIf you restrict his number lessons to just 0 and 1 as well, he can start writing those computer programs too! Posted by: C on August 9, 2006 7:46 AMThat is amazing. That's kindergarten level handwriting. Posted by: Anonymous on August 9, 2006 8:09 AMUm.. yeah, your son is freakishly advanced. Please don't let him be in my son's class. I want to continue to cling to the illusion that my kid is smart. But next to your kid he's gonna look retarded. Posted by: amy on August 9, 2006 8:13 AMClearly, he just wants to rent Gattaca. Why won't you listen to his needs, you selfish bastard? Posted by: john on August 9, 2006 10:03 AMOoh, be very careful going down that path, I've seen those letters before... that chinchilla has LASER BEAM EYES! Posted by: Friendless on August 9, 2006 9:51 PMHmmm thats funny I could have sworn chinchilla starts with caatacgttgacagttgagcttcgtcctgagtgcctaaacgctattgctacgtaca. Oh well, you say tomato... Posted by: Henri on August 10, 2006 12:04 AM |
|